HUBBSKY136GO HUBBSKY136GO

Health

Answered

Is this statement true or false?
Alcoholics Anonymous is a support group for the families of people with substance abuse addictions.
-true
-false

Answer :

MURPHYJESS111GO MURPHYJESS111GO

Answer:

I would say false.

Explanation:

I've always heard that AA is for alcoholics, not their families.

Answer Link

Go Question: Other Questions

This Is A Personal Question What Do You Do If Your Little Sister Will Not Stop Bothering You And You Are Home Allowen?

Please Solve Last Four Questions

Joe Is Making Lunch For His Crew. Joe Took 3 Hours To Prepare The Vegetables. The Vegetables Were Made Up Of 9 Kilograms. How Long Do You Think It Will Take Joe

Possible Answers: Conduction, Convection, Radiation Heat Is Carried Away From The Pot In All Different Directions. This Shows: Warm Water Rises Within The Pot.

What Is The Longest Time Difference That Can Be Found On The Map (consider Standard Time Only)? Give The Locations And The Time Zones Involved.

Why Could Thenotebook Have Fallenfrom Sayali's Hand? 

The Soccer Team Is/are Going To Win Today

What Fraction Of Students Scored 70-79 On The Math Test? Question 3 Options: 3/11 2/11 5/11 1/11

What Is The Meaning Of Dress Me In Borrow’d Robes As It Appears In This Passage? ROSS: And, For An Earnest Of A Greater Honour, He Bade Me, From Him, Call Thee

Linnaeus Used Similarities In Structure To Determine Relationships Among Organisms. Please Select The Best Answer From The Choices Provided T F

Matter Can Exist In Different Phases Or States. What Are Three Common States Of Matter? OA. Earth, Air, And Water ОВ. . Atoms, Elements, And Compounds OC. Solid

TACTTAGAGGCACCACATGGGCCTTGCACT To MRNA